Formica cunicularia Latreille, 1798

Primary tabs

EOL Text

Latr. Fourm. 151. Hub. Rech. Fourm. pl. 2, fig. 11, 12, 13. . Lep. de St. Farg. Hym. 203, 5. Losana Form. Piem. 10. Nyl. Adn. p. 913, 11.

 

Operaria t Ferrugineo-rufa vel rufescens, cinereo-micans, abdomine parce flavido-pilosulo; capite supra ad maximam partem, palpis, antennarum flagellis et abdomine castaneo-atris; thorace supra saepe et pedibus fuscescentibus, his interdum femoribus, vel totis pallidioribus; mandibulis rugosis haud conspicue punetatis, clypei carina distincta, foveolis lateralibus et area frontali subtilissima rugulosis, opacis; squama supra subtruncata vel leviter emarginata. Lg. 2-2 3/4 lin.

 

Feminat Ferrugineo-rufa, cinereo-micans, parcissime pilosula; capito ad maximam partem, palpis, antennarum flagellis et abdomine castaneo-atris; mesonoto raaculis tribus longitudinalis, una antica aliaque lateral! utrinque, scutello cum postscutello, mesopleuris cura mesosterno, tibiis et tarsis fuscis; squama lata vel subcordata, vel supra truncata, truncata leviter inaequali; alis hyalinis, nervis et stigmate fuscis. - (Nyl.) Lg. 3 1/2 lin.

 

Maa i Ater, cinereo-micans, genitalibus et pedibus totis, (exceptis coxis) testaceis, vel saepius tantum tarsis tibiisque cum femorum apicibus ejusdem coloris; oculis nudis; squama supra late concava; valvula ventrali sparse pilosa, disco fere toto subrotundatim plane impr'essiusculo. (Nyl) Lg. eirciter 4 lin.

 

Der Arbeiter dieser Art hat einen rothgefärbten Mittelleib, unterliegt aber in der Färbung desselben vielfachen Abänderungen , die so weit gehen, daß die rothe Farbe durch die braune gänzlichverdrängt wird. Der Kopf ist roth, Stirn und Scheite), der Umfang der Netzaugen und mehr oder weniger auch der Clypeus braun, die Taster und die Fühlergeißel , mit Ausnahme einiger Glieder an der Basis bräunlich . Die Mandibeln dicht längsrunzlich , nur an der Spitze mit einigen deutlichen, groben Punkten; der Clypeus und das Stirnfeld runzlig, matt, der erstre scharf gekielt, das letztre oben etwas stumpf; die Stirnrinne schwach, die Augen kahl, die Nebenaugen klein aber deutlich. Die Sculptur des Kopfes ist sehr Tein runzlig und ebenso fein und fast unmerkbar punktirt, mit feinen, anliegenden, grauen Härchen dicht bedeckt; dieselbe Beschaffenheit zeigt der Mittel- und Hinterleib. Am Kopfe finden sich nur einzelne Borstenhaare auf dem Scheitel. Der Mittelleib von Borstenhaaren gänzlichentblößt , die Grundfarbe desselben roth, der Rücken mehr oder weniger mit braunen Flecken, welche nach und nach sich ausbreiten und die rothe Färbung auf diese Weise verdrängen . An dem Hinterbrustrücken scheint der Basaltheil den abschüssigen noch an Länge zu übertreffen . Die Beine roth, mehr oder weniger zeigen die hintern Tibien auf der inneren Seite eine sehr schwache Borstenreihe, an den vordersten Tibien sind solche Borsten nur schwer zu erkennen. Die Schuppenach oben zugerundet und daselbst entweder fast abgestutzt oder leicht ausgerandet, der obere Rand oder auch die Schuppe selbst mehr oder weniger bräunlich . Die übrigen Segmente des Hinterleibs mit gelblichen, zerstreuten Borsten, welche auf der Bauchseite und dem letzten Segmente etwas gedrängter stehen und länger sind. Der Hinterrand der einzelnen Segmente etwas blaßhäutig .

 

Das Weibchen ist durch die in der Diagnose angegebenen Merkmale leicht su erkennen. Der Clypeus ein wenig unterhalb des Stirnfeldes querüber etwas eingedrückt . Der Kopf schwarzbraun; die Mandibeln, die Wangen, das Kinn und der Fühlerschaft mehr oder weniger roth. Die Fühler schlanker als bei dem Weibchen der F. rufa . Die Flügel wasserhell, ein wenig weißlich , die Ädern und das Randmal braun. Die Schuppe fast dreiseitig zugerundet, der Rand oben entweder etwas ungleich oder buchtig ausgerandet, so daß sie dadurch meist fast herzförmig wird. Der Hinterleib ganz braunschwarz, stark grauschimmerd, die Segmente an der Spitze ein wenig blaßhäutig , das lezte Segment roth.

 

Das Männchen dieser Art ist dem Männchen der F. rufa sehr ähnlich , aber verschieden davon durch längere Taster, durch ein mattes, nicht glänzendes Stirnfeld, nakte Augen und wasserhelle Flügel mit deutlich braungefärbten Adern. Das 4te Glied der Lippentaster ist doppelt so lang wie dasselbe Glied bei F. rufa . Die Schuppe querüber fast eiförmig , oben breit vertieft. Die Tarsen bräunlichgelb .

 

Von dieser Art besitze ich aus der Nähe von Aachen und Stollberg nur die Arbeiter. Ihre Lebensweise stimmt genau mit Nyl. Aussage, welcher von derselben ganz richtig bemerkt: Nidulatur in terra, potissime arenosa, nullum vero acervum construit. Sollicitata timide aufugit latebras petens, sed periculo nimio" instante diebus inprimis calidis impavide arma sua adhibet. (V. Nyl. Adn. p. 914.) Ich finde sie hier sowohl unter Steinen wie in freier Erde, und habe auch nie die Anlage zu einem Nesterbau bei derselben bemerkt.

License
Rights holder/AuthorNo known copyright restrictions
Sourcehttp://antbase.org/ants/publications/8138/8138.pdf

Taxonomic History:
Formica cunicularia Latreille, 1798 PDF: 40 (w.q.m.) FRANCE. AntCat AntWiki

Taxonomic history

Combination in Formica (Serviformica): Forel, 1915d: 64.
Junior synonym of Formica rufibarbis: Walckenaer, 1802: 161; Dalla Torre, 1893: 209; Ruzsky, 1905b: 385; Forel, 1915d: 64; Emery, 1916a PDF: 255; Emery, 1925d PDF: 250.
Revived from synonymy and status as species: fusca L. (Hym., Formicidae). Transactions of the Society for British Entomology 11:229-244. [1954-07-14]">Yarrow, 1954a PDF: 231.
Senior synonym of Formica rubescens: fusca L. (Hym., Formicidae). Transactions of the Society for British Entomology 11:229-244. [1954-07-14]">Yarrow, 1954a PDF: 231; (Hymenoptera, Formicidae, g. Formica). [In Russian.]. Moskva: Nauka Publishing House, 236 pp. [1967-03-14>]">Dlussky, 1967a PDF: 73; Bernard, 1967a PDF: 296; rufibarbis Fabricius, 1793 group (Hymenoptera: Formicidae). Myrmecological News 12:255-272. [2009-09]">Seifert & Schultz, 2009B PDF: 261; of Formica fuscorufibarbis: (Hymenoptera, Formicidae, g. Formica). [In Russian.]. Moskva: Nauka Publishing House, 236 pp. [1967-03-14>]">Dlussky, 1967a PDF: 73; Dlussky & Pisarski, 1971 PDF: 166; of Formica glebaria: Bernard, 1967a PDF: 296; Boven, 1977: 164; Agosti & Collingwood, 1987a PDF: 59; of Formica glauca (and its junior synonyms Formica caucasica, Formica katuniensis, Formica montivaga, Formica montaniformis, Formica volgensis): Atanassov & Dlussky, 1992: 267; of Formica fuscoides: Arakelian, 1994 PDF: 94; rufibarbis Fabricius, 1793 group (Hymenoptera: Formicidae). Myrmecological News 12:255-272. [2009-09]">Seifert & Schultz, 2009B PDF: 261.
Licensehttp://creativecommons.org/licenses/by-nc-sa/1.0/
Rights holder/AuthorAntWeb
Sourcehttp://www.antweb.org/description.do?genus=formica&name=cunicularia&rank=species

Formica cunicularia, Latr . Fourm. 151. Nyland. Adno. Mon. Form. Boreal. 913, 11. Foerster, Hym. Stud. Form. 26,9.

 

Female (length 4 lines). Antennae, face below them, the mandibles, thorax, legs and scale of the abdomen bright ferruginous; the disk of the thorax of a dark red-brown, or with three or four spots of that colour; the antennae are darker towards their apex the scale is very slightly notched; abdomen of an ashy black; at the base and beneath having a ferruginous tinge: the wings are hyaline, but slightly smoky towards their base; the nervures, are testaceous, the stigma brown.

 

Worker (length 2 - 23 / 4 lines). This sex is similarly coloured to the female, but altogether duller; and the thorax is more elongate and narrowed towards the metathorax; the abdominal scale is not notched, and the legs more elongate than in the female.

 

Male (length 4 lines). Black; the legs and tip of the abdomen of a pale reddish yellow; the scale is quadrate and deeply notched above; the wings hyaline, but smoky towards their base, the nervures testaceous, the stigma brown: abdomen elongate, about the same width as the thorax, and having a bright silky gloss. (All the sexes taken from the same nest.)

 

Note. - The male closely resembles that of Formica fusca , but distinguished by having the externo-medial nervure continued to the base of the wing; in fusca it becomes obsolete.

License
Rights holder/AuthorNo known copyright restrictions
Sourcehttp://antbase.org/ants/publications/8200/8200.pdf

Formica cunicularia Latreille , 1798

Formica cunicularia Latreille , 1798; France . Formica fusca var. rubescens Forel , 1904; Switzerland : Vaux .

Formica cunicularia fuscoides Dlussky , 1967; Armenia : Byurakan .

Type material examined: F. cunicularia : Neotype worker labelled "FRA: 44.4947° N , 0.9597° E , Fumel , 120 m, in a garden, leg. Galkowski 2008.07.25" and " NeotypeFormica cunicularia Latreille 1798, des. Seifert & Schultz 2009"; SMNGörlitz . In case of destruction or loss of the neotype specimen, a replacement neotype can be designated from a series of five mounted workers from the same nest series in SMNGörlitz and further five workers in MNHN Paris.

Justification of the neotype fixation: A current search in the Latreille collection of MNHN Paris failed to detect a specimen interpretable as a primary type (J. Casevitz-Weu-lersse, pers. comm. 2008) and the literature gives no indication that a revisor ever has seen one. In order to establish an unambiguous standard for differentiation from similar species, we fixed a neotype in a sample from the terra ty-pica which is in agreement with the traditional morphological conception of F. cunicularia .

F. fusca var. rubescens : 4 syntype workers labelled by Forel himself " Vaux ", " Cotypus " and " F. fusca r. glebaria v. rubescens For ", MZ Lausanne.

F. cunicularia fuscoides : Five workers from the holo-type nest, labelled "1103", " Byurakan 1800 m Armen. Dlusskij 13.VI. 960" [in cyrillic letters], " Formica cunicularia kajastanica Dlusskyparatypes ". Serial No. 1103 definitely designates the holotype nest (Dlussky 1967 , p. 74) but a holotype cannot be identified within these five specimens. They are paratypes at least. A " F. c. kajastanica " has never been validly published. One gyne and two workers labelled "1091" and " Alagez nad Byurakanom Armeniya G. Dlusskij 13. 6.60" were also explicitly mentioned by Dlussky and have paratype status.

Material examined: 85 samples with 307 workers were subject to a numeric analysis of 18 characters (Figs. 20, 21): Armenia (2 samples), France (12), Georgia (5), Germany (24), Great Britain (1), Greece (3), Hungary (3), Italy (10), Kazakhstan (7), Portugal (1), Russia (1), Spain (1), Switzerland (2), Turkey (11), Ukraine (2). For details, see Appendix, as digital supplementary material to this article, at the journal's web pages.

Description of worker, continental population (Tab. 1, Figs. 1, 4): medium-sized Serviformica species (CS 1.365 mm); head slightly elongated (CL / CW1.4 1.131); Scape moderately long SL / CS1.4 1.073; distance of lateral ocelli moderate (OceD / CS1.4 0.164); eyes rather large (EYE / CS1.4 0.301), petiole rather wide (PEW / CS1.4 0.468). Clypeus with sharp median keel and fine longitudinal micro-carinulae. Frontal triangle finely transversely rippled and with 30 - 60 short pubescence hairs. Eyes with microsetae of 7 - 13 μ m maximum length. Total mean of unilateral setae numbers on different body parts predicted for a specimen with CS = 1.4 mm: pronotum 1.1, mesonotum 0.8, petiole scale dorsal of spiracle 0.25, flexor profile of hind tibia 0.3. Posterior margin and underside of head and dorso-lateral metapleuron as a rule without setae. Ventral coxae with long setae, dorsum of gaster with scattered, moderately long setae. Dorsal mesonotum in lateral aspect broadly rounded. Metanotal depression in larger individuals relatively deep. Propodeal dome rounded in lateral view, basal profile sometimes concave and in smaller specimens often straight. Dorsal crest of petiole in frontal view bluntly angled in smaller specimens to broadly convex in larger specimens, in some of the large individuals with straight or weekly excavate median portion. Petiole scale in lateral aspect rather thin, with convex anterior and more straight posterior profile. Gaster with transverse microripples of small average distance (RipD 4.6 μ m) and covered by dense silvery pubescence (sqPDG 3.1). Pubescence on head, meso-soma and petiole dense. Typical colour pattern: Head with exception of round reddish-yellowish spots on anterior ge-nae, dorsal promesonotum, coxae and all appendages dark brown, gaster blackish brown. Other body parts more or less reddish-yellowish. Nests with much lighter specimens having whole mesosoma, coxae and petiole uniformly reddish and such with very dark specimens having the reddish pigmentation reduced to a very small spot on frontal margin of ventrolateral mesonotum; exceptionally completely dark specimens occur.

Description of worker, West Mediterranean isolated populations: We do not at this time propose these deviating and isolated populations from Corsica, Sardinia and the Sierra Nevada as heterospecific from F. cunicularia . Differences to the continental population are a significantly narrower petiole (PEW / CS1.4 0.433) and slightly longer 1 st tergite setae (GHL / CS1.4 7.24%). It seems to be the only species of the group from Corsica where F. clara and F. rufibarbis have not been reported so far.

Comments on taxonomy: The separation of F. cunicu-laria and F. clara represents the most difficult discrimination problem within the F. rufibarbis group because there is a deficiency of strongly discriminating structural characters. We ran a DA for the whole Palaearctic range of F. clara excluding material from the West Himalayas (Pakistan and India) where no ant species similar to F. cuni-cularia is present. Considering the characters CS, CL / CW1.4, SL / CS1.4, OceD / CS1.4, EYE / CS1.4, PEW / CS1.4, nPN1.4, nMN1.4, nPRME1.4, nPE1.4, nHFFL1.4, RipD1.4, sqPDG1.4, PIGM 1.4, and CONT 1.4, a two-class DA separates 97.4% of 268 nest samples with p> 0.95 and the LOOCV-DA gives an error prediction of 0.4% (Fig. 14): D (15) F. clara -2.781 ± 0.864 [-4.40, -0.17] n = 183 D (15) F. cunicularia -2.642 ± 1.245 [0.17, 5.22] n = 85

The neotype sample of F. cunicularia , the syntype sample of F. fusca var. rubescens and the holotype sample of F. cunicularia fuscoides are safely allocated to the F. cuni-cularia cluster (each with p = 1.000) while syntype sample of F. clara Forel , 1886, the holotype sample of Formica lusatica Seifert , 1997 and the syntype sample of F. rufi-barbis var. sinae Emery , 1925 are safely assigned to the F. clara cluster (each with p = 1.000). While these type allocations allow clear nomenclatural decisions at least within this species pair, we do not fully trust any determination within the complete data set. The weak point is that intraspecific colour polymorphism and loss of pigmentation by light or storage media could possibly affect the reliability of the pigmentation characters PIGM and CONT, but just these two characters have the largest loadings (canonical correlations) in the DA. These loadings are 0.788 in PIGM 1.4 and 0.391 in CONT 1.4 but only 0.336 in EYE1.4 and 0.170 in nPN1.4, the two best structural discriminators. Another problem are the isolated West Mediterranean populations of F. cunicularia from Corsica, Sardinia and the Sierra Nevada which were all allocated in the DA to the F. cunicularia cluster but possibly represent a third species. We have currently no NUMO-BAT method to show this. Integrative approaches including DNA analysis could bring more clarity into this issue.

Fig. 14: Discriminant analysis of worker nest samples considering 15 characters of the Palaearctic population of F. clara and F. cunicularia . Position of type samples shown by arrows: CL - F. clara , L - F. lusatica , CU - F. cunicu-laria, R - F. fusca var. rubescens , F - F. cunicularia fus-coides , S - F. rufibarbis var. sinae .

85 samples with 307 workers were subject to a numeric analysis of 18 characters. Armenia : Alages ( type fuscoides, paratype fuscoides), 13.VI.1960 [ 40.33° N , 44.25° E , coordinates estimated]. France : Breil sur Roya (No. 001), 7.V.2002 [ 43.942° N , 7.518° E ]; Breil sur Roya (No. 025), 8.V.2002 [ 43.951° N , 7.519° E ]; Breil sur Roya (No. 038), 9.V.2002 [ 43.924° N , 7.484° E ]; Corse (D 81) 5.VI.1985 [ 42.467° N , 8.683° E ]; Fumel ( neotype cunicularia), 25.VII.2008 [ 44.495° N , 0.960° E ]; Galeria , 13.VI.1985 [ 42.410° N , 8.650° E ]; Labergement-Sainte-Marie , 11.VII.1990 [ 46.770° N , 6.280°]; Lac de L'Oriente , 5.VII.1974 [ 42.229° N , 9.058° E ]; Orne , 1917 [ 48.81° N , 0.26° E , coordinates estimated]; Suartone , 6.VI.1975 [ 41.5° N , 9.25° E , coordinates estimated]; Timozzo , 5.VII.1974 [ 42.244° N , 9.067° E ]; MNHNParis ( EY0000001658) [without date and location]. Georgia : Kazbergi (2 samples, No. 654, 644), 27.VII.1985 / 8.VIII.1985 [ 42.670° N , 44.580° E ]; Mzcheta , 23.VII.1985 [ 41.840° N , 44.720° E ]; Omalo (2 samples, 650, 653m), 31.VII.1985 [ 42.380° N , 45.630° E ]. Germany : Burkheim , 1.V.1993 [ 48.100° N , 7.600° E ]; Dänkritz , 27. V.1992 [ 50.770° N , 12.430° E ]; Ebersbach (3 samples, No. 026, 076, 222), 24.V.1992 [ 51.190° N , 14.930° E ]; Först-gen , 8.V.1994 [ 51.300° N , 14.640° E ]; Griesheimer Duene , 29.IV.1993 [ 49.840° N , 8.590° E ]; Heilsberg , 25.VIII.1986 [ 50.776° N , 11.265° E ]; Isteiner Klotz , 4.V.1993 [ 47.670° N , 7.530° E ]; Langenhessen (3 samples, No. 053, 054, 067), 28.V.1992 [ 50.770° N , 12.370° E ]; Klein Schmoelen , 4.VIII.1996 [ 53.123° N , 11.289° E ]; Lubminer Heide , 14.VI.1998 [ 54.147° N , 13.647° E ]; Neubrandenburg , 20.VI.1998 [ 53.596° N , 13.409° E ]; Niederhohndorf (2 samples, No. 076, 084), 26.V.1992 [ 50.750° N , 12.470° E ]; Rengersdorf (2 samples, No. 054, 234), 20.V.1992 [ 51.208° N , 14.892° E ]; Rohrdorf,8.V.1993 [ 47.717° N , 10.083° E ]; Torga , 20.V.1992 [ 51.208° N , 14.910° E ]; Trebbichau , 31.V.1987 [ 51.810° N , 12.010° E ]; Vogtsburg , 3.V.1993 [ 48.100° N , 7.700° E ]; Waren/Feissnecksee , 27.VII.1988 [ 53.490° N , 12.710°]. Great Britain : Hartland Moor , 24.X.1991 [ 50.657° N , 2.092° W ]. Greece : Agia Triada , 1.VI.2001 [ 40.500° N , 22.882° E ]; Litochoro , 29.V.2001 [ 40.102° N , 22.562° E ]; Nestos Delta (No. 1), 2004 [ 40.850° N , 24.800° E ]. Hungary : Aggtelek (3 samples, No. 004, 005, 006), V.1998 [ 48.467° N , 20.517° E ]. Italy : Baunei , 5.X.1972 [ 40.120° N , 9.510° E ]; Camigli-atello Silano (No. 003), 14.V.1999 [ 39.376° N , 16.441° E ]; Camigliatello Silano (No. 005), 14.V.1999 [ 39.363° N , 16.456° E ]; Camigliatello Silano (No. 023), 16.V.1999 [ 39.361° N , 16.430° E ]; Firenze , 20.VII.1994 [ 43.783° N , 11.600° E ]; Largo Arvo , 19.V.1994 [ 39.230° N , 16.500° E ]; Mte. Limbara , 3.V.1994 [ 40.850° N , 9.180° E ]; Sila Grande (No. 029), 17.V.1999 [ 39.392° N , 16.550° E ]; Sila Grande (No. 049), 20.V.1999 [ 39.387° N , 16.559° E ]; Sila Grande (No. 061b), 21.V.1999 [ 39.411° N , 16.553° E ]. Kazakhstan : Manrak , 27.VII.2001 [ 47.317° N , 84.617° E ]; Sarymobe (2 samples, No. 197a, 206), 5.VIII.2001 [ 47.130° N , 82.372° E ]; Saur (No. 082), 25.VII.2001 [ 47.357° N , 85.518° E ]; Tarbagatay (No. 160), 1.VIII.2001 [ 47.784° N , 81.754° E ]; Tarbagatay (No. 306), 5.VIII.2001 [ 47.133° N , 82.367° E ]; Tarbagatay (No. 338), 1.VIII.2001 [ 47.783° N , 81.767° E ]. Portugal : Porto Covo , 15.III.2002 [ 37.839° N , 8.788° W ]. Russia : Kursk steppe, 17.VII.1999 [ 51.750° N , 36.167° E ]. Spain : Veleta S, 10.V.1991 [ 37.060° N , 3.360° W ]. Switzerland : Pfynwald (No. g21) 16.V.1994 [ 46.300° N , 7.620° E ]; Vaux (cotype rubescens), [ 46.540° N , 6.470° E , coordinates estimated]. Turkey : Catak , 18.VI.1993 [ 39.500° N , 43.010° E ]; Dagpinar , 23.VI.1993 [ 40.470° N , 43.330° E ]; Dirimli Gecidi , 22.V.1993 [ 36.870° N , 29.580° E ]; Dranoz , 3.VII.1993 [ 41.640° N , 34.840° E ]; Kabali , 3.VII.1993 [ 41.800° N , 35.050° E ]; Ödemis (No. 870), 19.V.1993 [ 38.350° N , 27.880° E ]; Sac Gecidi , 22.VI.1993 [ 39.800° N , 42.510° E ]; Sarigöl (No. 1177), 28.VI.1993 [ 41° N , 41.5° E , coordinates estimated]; Sogukpinar (2 samples, No. 1229, 1238), 6.VII.1993 [ 40.060° N , 29.120° E ]; Stranga Mts. , 10.V.2003 [ 41.468° N , 27.375° E ]. Ukraine : Jalta , 16.VIII.1995 [ 44.450° N , 34.050° E ]; Manhup-Kale, 12.VIII.1995 [ 44.617° N , 33.867° E ].

Distribution and biology: Temperate, Ponto-south-Siberian and Submediterranean species of the West Palae-arctic, occurring from southernmost England and Iberia to West Siberia ( 85° E ). In northwestern Europe, it goes north to southern Sweden ( 58° N ) but has not reached southern Finland so far. Having a planar to colline distribution in the northern parts of its range, it climbs up to 1800 m in the Alps, up to 2400 m in the Caucasus and up to 2000 m in the South Siberian Tarbagatay Mountains.

Moderately thermophilic. Preferred habitats are meagre and semidry grasslands on differing geological outcrop, more rarely extremely xerothermic grasslands and also open ruderal, rural or disturbed habitats, including road or railway verges. In contrast to F. rufibarbis more frequently occurring on loamy soils with more developed herb layer and less often invading the urban zone. Presence, mean and maximum nest density on 81 potentially suitable, 150- m 2-test-plots on open land in Germany 5%, 1.6 and 23.2 nests / 100 m 2 respectively. Colony foundation usually by single gynes but also pleometrotic. Nests moderately populous, usually containing 1000 - 1800 workers, sometimes weakly polygynous, but polydomous colonies unknown (as in all members of the group). Usually inhabits simple soil nests, construction of high mounds of mineral soil in meagre grassland with higher herb layer regularly observed. Usually timid and fugitive, but populous nests with large workers may be very aggressive during nest defence. Not territorial. Foraging at surface temperatures of up to 50° C, mainly on open surfaces and in the herb layer, but not avoiding bushes and trees. Zoophagous, trophobiotic and nectarivorous. Low position in dominance hierarchies of ant communities, usually inferior to even Lasius niger (Linnaeus, 1758), whom it carefully evades thanks to superior walking speed and well-developed visual sense, thus enabling coexistence at long-term food sources. May snatch large prey items from L. niger by swift surprise attack. Favoured host species for several socially parasitic ant species. Alates occur 7 July ± 12 d [ 16 June , 1 August ], n = 17 (Seifert 2007 ).

LicensePublic Domain
Rights holder/AuthorNo known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.
Sourcehttp://treatment.plazi.org/id/FCC4EFD8F4F77508B5E07BDBC1FB2C29

The Mining Ant. B. M.

 

Hist. Nat. Fourm. 151. St. Farg. Hist.

 

Nat. Ins. i. 203, 5, Formica obsoleta, Latr . Essai, 38. Formica pratensis, Oliv . Enc. Meth, vi. 504. Formica media, Ray , Hist. Ins. 69. Huber, 324, 2, f. 11, 12, 13.

 

Hab. - Highgate, Banks, & c.

License
Rights holder/AuthorNo known copyright restrictions
Sourcehttp://antbase.org/ants/publications/8200/8200.pdf

11. F. cunicularia Latr HNS .

Fourni. 151. Huber Rech. Fourm, pl. 2, fig. 11, 12, 13. . Lepelet. S: t Farg. Hym. 203, 5. Losana Form. Piem. 10.

Operaria: ferrugineo-rufa vel rufescens ciuereo-micans, parce flavido pilosula; capite supra ad maximam partem, palpis, antennarum flagellis et abdomine castaneo-atris; tborace supra saepe et pedibus fuscescentibus, his interdum femoribus vel totis pallidioribus; carina clypei distincta; squama supra subtruncata vel leviter emarginata.

Femina: ferrugineo-rufa cinereo-micans, parcissime pilosula; capite ad maximam partem, palpis antennarum flagellis et abdomine castaneo-atris; mesonoto maculis tribus longitudinalibus, una antica allaque laterali utrinque, scutello cum postscutello, mesopleuris cum mesosterno, tibiis et tarsis fuscis; squama lata, vel subcordata, vel supra truncata, tantum leviter inaequali; alis hyalinis, nervis et stigmate fuscis.

Mas: ater cinereo-micans, genitalibus et pedibus totis, exceptos coxis, testaceis, vel saepius tantum tarsis tibiisque cum femorum apicibus ejusdem coloris; oculis nudis; squama supra late concava; valvula ventrali sparse pilosa, disco fere toto subrotundatim plane impressiusculo.

Hab. inde ab Europa meridonali ad Fenniam saltem maxime borealem; in Fennia tota frequens. Nidulatur in terra, potissime arenosa, nullum vero acervum construit. Sollicitata timide aufugit latebras petens, sed periculo nimio instante diebus inprimis calidis impavide arma sua adhibet. Mares feminaeque in Fennia intra d. 20 Julii - 10 Aug. obveniunt.

. Long. circ. 2 1 / 2 lin. Simillima F. rufae, sed differt: canescentia micante corporis ditiori, palpis maxillaribus longioribus, antennarum scapo pauxillum longiori, area frontis triangulan inter radices antennarum opaca (nec ut in F. rufa polita HNS ), oculis fere majoribus magis oblongis, squama subtriangulariter rotundata supra subtruncata, abdomine ovato minori obscuriori. Palpi maxillares prosternum paene attingentes, proportione articulorum ut in F. rufa HNS , sed graciliores. Caput nigrofuscum, mandibulis, clypeo, genis, scapis et infra plus minus rufis. Thorax et squama saspe supra fuscis. Tibias saltem postiriores latere interiori setulis nonnullis. Abdomen segmentorum marginibus summis membranaceis obsoletissime pallescentibus; ano summo rufescente.

. Long. fere 3 1 / 2 lin. Notis in diagnosi allatis mox dignota. Clypeus partim intra aream triangularem frontis opacam recta paulum impressus. Caput nigrofuscum-, mandibulis, genis, mento et scapis plus minus rufis. Antennae graciliores quam in F. rufa HNS . Alae hyalinae parum albescentes, nervis et stigmate fuscis. Squama subtriangulariter rotundata, supra vel margine parum inaequali vel sinuatim emarginate, ut subcordata plerumque evadat. Abdomen totum fusco-nigrum valde cinereo-micans, segmentis apice summo parum membranaceo-palleseente, ano rufescente,

. Long, circiter 4 lin. notis ut supra. Simillima F. rufae , sed jam differt: palpis longioribus, area frontis triangulan opaca, oculis nudis et alis hyalinis nervis conspicue fuscis. Palporum labialium articulus 4: tns est duplo longior quam idem articulus in F. rufa HNS . Valvula ventralis ut in diagnosi. Squama transversim subovalis supra late concava. Tarsi cinerascenti-testacei.

B. Nigrae: colore corporis dominante nigro, piceo, vel fusco. Operarias ocellis minutis vel minutissimis. (Sp. 12 - 17).

LicensePublic Domain
Rights holder/AuthorNo known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.
Sourcehttp://treatment.plazi.org/id/F287EF4FE5F5FF25C4CF265E70683CB0

Barcode data: Formica cunicularia:

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

ATTCCTCTAATACTTGGGTCTCCAGACATAGGCTATCCTCGTATAAATAATATAAGATTTTGACTCTTACCTCCCTCTATTACTCTTTTACTCTTAAGAAATTTTATTAATGATGGTACAGGAACAGGTTGAACTATTTACCCCCCCTTAGGTTCAAACAATTTTCATAAAGGACCTCCTGTAGACTTAACGATTTTCTCTCTACATATTGGAGGTATTTCTCCAATTTTAGGAGCAATCAATTTTATTTCAACAATTCTTAATTTTCATCATAAAAATTTTTCTTTTGATAAAATTCCCTTACTTGTATGATCAATTTTAAGAACAGCTATCTTACGAATATTAACCTTACCTGTTTTAGCAGGAGCTATTACTATTCTATTAACTGATCGAAACTTAAATACTTCATTCTTTGATCCTTCAGGGGGGGGTGACCCAAGTCTTTACCAACATTTATTTTGATTTTTTGGCCATCCAGAAGTTTATATTTTAATTTTACCAGGATTTGGATTAATTTCTCATATTATTATAAATGAAAGAGGTAAAAAAGAAACTTTTGGAGCTTTAGGAATAATTTATGCTCTTATAGCAATCGGATTCTTAGGATTTGTTGTTTGAGCCCATCATATATCTACAATTGGCTTAGATGTCGATACACGAG
-- end --


Download FASTA File

Licensehttp://creativecommons.org/licenses/by/3.0/
Rights holder/AuthorSujeevan Ratnasingham, Paul D.N. Hebert, Barcode of Life Data Systems (BOLD)
Sourcehttp://www.boldsystems.org/index.php/Taxbrowser_Taxonpage?taxid=33162

3. Formica cunicularia HNS .

The Mining Ant. B. M.

Formica cunicularia, Latr HNS .

Hist. Nat. Fourm. 151. St. Farg. Hist.

Nat. Ins. i. 203, 5, Formica obsoleta, Latr HNS . Essai, 38. Formica pratensis, Oliv HNS . Enc. Meth, vi. 504. Formica media, Ray HNS , Hist. Ins. 69. Huber, 324, 2, f. 11, 12, 13.

Hab. - Highgate, Banks, & c.

LicensePublic Domain
Rights holder/AuthorNo known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.
Sourcehttp://treatment.plazi.org/id/CF4FAC7023C5B47916D73560B9D5A434

Statistics of barcoding coverage: Formica cunicularia:

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 4
Species With Barcodes: 1

Licensehttp://creativecommons.org/licenses/by/3.0/
Rights holder/AuthorSujeevan Ratnasingham, Paul D.N. Hebert, Barcode of Life Data Systems (BOLD)
Sourcehttp://www.boldsystems.org/index.php/Taxbrowser_Taxonpage?taxid=33162

FORMICA CUNICULARIA HNS .

Formica cunicularia, Latr HNS . Fourm. 151. Nyland. Adno. Mon. Form. Boreal. 913, 11. Foerster, Hym. Stud. Form. 26,9.

Female (length 4 lines). Antennae, face below them, the mandibles, thorax, legs and scale of the abdomen bright ferruginous; the disk of the thorax of a dark red-brown, or with three or four spots of that colour; the antennae are darker towards their apex the scale is very slightly notched; abdomen of an ashy black; at the base and beneath having a ferruginous tinge: the wings are hyaline, but slightly smoky towards their base; the nervures, are testaceous, the stigma brown.

Worker (length 2 - 23 / 4 lines). This sex is similarly coloured to the female, but altogether duller; and the thorax is more elongate and narrowed towards the metathorax; the abdominal scale is not notched, and the legs more elongate than in the female.

Male (length 4 lines). Black; the legs and tip of the abdomen of a pale reddish yellow; the scale is quadrate and deeply notched above; the wings hyaline, but smoky towards their base, the nervures testaceous, the stigma brown: abdomen elongate, about the same width as the thorax, and having a bright silky gloss. (All the sexes taken from the same nest.)

Note. - The male closely resembles that of Formica fusca HNS , but distinguished by having the externo-medial nervure continued to the base of the wing; in fusca HNS it becomes obsolete.

LicensePublic Domain
Rights holder/AuthorNo known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.
Sourcehttp://treatment.plazi.org/id/A2436FDE45811671CCEA6395E7E0DBC4
Scratchpads developed and conceived by (alphabetical): Ed Baker, Katherine Bouton Alice Heaton Dimitris Koureas, Laurence Livermore, Dave Roberts, Simon Rycroft, Ben Scott, Vince Smith