Lasius alienus Foerster, 1850

Primary tabs

EOL Text

Lasius alienus is a dull brown species with lighter brown appendages, dense pubescence, and a truncated propodeum. Under the current taxonomic concept (Seifert, 1992; Wilson, 1955), L. alienus has one of the most widespread native ranges of any ant species, spanning the Holarctic from the west to east coast of North America through Western Europe and Central Asia east to Japan. Whether these widely separated populations truly represent a single species or are actually a complex of cryptic species is a question of some debate (Seifert, 1992;2009). The bi-continental distribution, perhaps together with the unfortunate specific epithet, has caused led some to consider L. alienus an alien species in North America (Maerz et al., 2009; McGlynn, 1999a). While the North American population may well prove to be a species distinct from the Eurasian populations, the preferred habitats, broad distribution and general biology suggest that its occurrence on the continent preceded the arrival of humans. The ants are monogynous, eat both dead and live insects, gather nectar from the floral and extrafloral nectaries of plants, tend honeydew-excreting insects, and foster and transport certain subterranean plant lice from the roots of one plant to another. These latter habits cause L. alienus to sometimes be considered an agricultural pest (Smith, 1965). The species is also considered a house pest in some areas, as it is tends agricultural pests and is prone to enter dwellings in search of food and shelter (Smith, 1965; Thompson, 1990). The name ‘Cornfield Ant’ is sometimes applied to Lasius species, including L. alienus, but its use is perhaps better confined to L. neoniger which was discovered to have a mutualistic relationship with corn root aphids. 

Licensehttp://creativecommons.org/licenses/by-sa/3.0/
Rights holder/AuthorEli Sarnat, Antkey
Sourcehttp://antkey.org/node/32623

Lasius neglectus

Licensehttp://creativecommons.org/licenses/by-sa/3.0/
Rights holder/AuthorEli Sarnat, Antkey
Sourcehttp://antkey.org/node/32623

34 . Lasius alienus HNS (Forster, 1850)

Figs. 128-130.

Formica aliena Forster HNS , 1850:36.

Worker. Greyish yellow to brownish black. Pubescence adpressed, moderately thick over whole body and appendages. Short erect hairs scattered over dorsum and round whole occipital margin of head. Back of head convex. Ocelli indistinct or invisible; frontal furrow indistinct. Erect hairs absent on scape and front tibiae, sometimes present on hind tibiae. Length: 3.0-4.2 mm.

Figs. 128-130. Lasius alienus (Forster) HNS . - 128: head and alitrunk of queen in profile; 129: male in profile; 130: head of worker in dorsal view. Scale: 1 mm.

Figs. 131, 132. Lasius brunneus (Latr.) HNS . - 131: head of worker in dorsal view; 132: head of male in dorsal view. Scale: 1 mm.

Queen . Greyish black to brownish black. Wings hyaline. Head much narrower than broad alitrunk. Pubescence and pilosity as in worker, no erect hairs on scape and front tibiae. Length: 8.0-9.0 mm.

Male. Greyish black. Wings hyaline. No erect hairs on tibiae or scapes. Length: 3.0-3.8 mm.

Distribution. Common in Denmark and South Sweden; in Norway only recorded from. O, HE and VE; in Finland recorded as far north as Ob and Ks. - Common in South Britain, local in Ireland and Southwest Scotland. - Range: Portugal to Japan also Himalayas, North Africa to Finland. Also North America (Wilson, 1955).

Biology. This wide ranging species nests in the soil on sandy lowland heaths, dry open pasture, sea cliffs and rocky outcrops in North Europe. Its habits are mainly subterranean, feeding on the exudates of root aphids but also by scavenging and predating small insects. Workers are generally unobtrusive and non aggressive compared with Lasius niger HNS . Nests are single queened founded by solitary fertilised queens. Mating swarms occur in August.

LicensePublic Domain
Rights holder/AuthorNo known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.
Sourcehttp://treatment.plazi.org/id/8DDA1C67539F5BDC475D1FA714E00D1B

Associations:

Animal / guest
larva of Clytra laeviuscula is a guest in nest of Lasius alienus s.s.

In Great Britain and/or Ireland:
Animal / guest
worker of Myrmecina graminicola is a guest in nest of Lasius alienus s.s.

Licensehttp://creativecommons.org/licenses/by-nc-sa/3.0/
Rights holder/AuthorBioImages, BioImages - the Virtual Fieldguide (UK)
Sourcehttp://www.bioimages.org.uk/html/Lasius_alienus.htm

Lasius alienus Foerst HNS .'

Laverdure (sur les chênes-liège ); Bône .

LicensePublic Domain
Rights holder/AuthorNo known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.
Sourcehttp://treatment.plazi.org/id/6A2B7F1674CB0151D4682E1D74F7591F

Associations:

Animal / sequestrates
queen (newly mated) of Lasius mixtus takes over nest of Lasius alienus s.l.

Animal / sequestrates
queen (newly mated) of Lasius umbratus takes over nest of Lasius alienus s.l.

Licensehttp://creativecommons.org/licenses/by-nc-sa/3.0/
Rights holder/AuthorBioImages, BioImages - the Virtual Fieldguide (UK)
Sourcehttp://www.bioimages.org.uk/html/Lasius_alienus.htm

Myrmelachista Rogeri HNS nov. sp.

Ouvriere: Antennes de 9 articles. Tout le corps lisse et tres luisant. D'un brun-marron fonce, presque noir; mandibules et partie anterieure de la tete plus rougeatres; antennes, articulations des pattes et tarses d'un jaune sale. Pubescence nulle; pilosite tres eparse; funicule avec une pubescence un peu relevee et assez abondante. Pronotum et mesonotum formant ensemble (vus en dessus) un hemisphere un peu aplati; mesonotum separe du metanotum par un profond etranglement; face basale du metanotum horizontale, au moins aussi longue que sa face declive. Ecaille cuneiforme, un peu inclinee en avant, tres epaisse a la base, amincie et plus ou moins echancree au sommet. - Long., 1 2 / 3 - 2 mill.

Cuba.

Parait etre voisine de la M. Kraatzi Roger HNS , qui ne m'est connue que par la description de son auteur, mais s'en eloigne par sa couleur tout autre et par la conformation de son petiole.

LicensePublic Domain
Rights holder/AuthorNo known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.
Sourcehttp://treatment.plazi.org/id/5C69E6051FBE06AF6546D6AD463614AA

Barcode data: Lasius alienus:

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATAATCATTCGACTAGAATTAGGCTCTTCTAATTCATTAATTAATAAT---GATCAAATTTATAATTCTATAGTTACAAGACATGCATTCGTTATAATTTTCTTTATAGTTATACCTTTTATAATTGGAGGATTTGGAAATTTTCTTGTACCTTTAATA---TTAGGCTCACCTGATATAGCATACCCCCGTATAAATAATATAAGATTTTGACTTTTACCTCCCTCAATTTCTCTCCTTCTTTTAAGAAATTTTATTAATGACGGAGTCGGAACAGGATGAACTGTTTATCCTCCATTAGCTTCTAATATTTTTCATAATGGCCCTTCAGTTGACTTA---ACTATTTTTTCTCTTCATATTGCTGGTATATCTTCTATTCTAGGAGCTATCAATTTTATTTCAACTATTATAAATATACATCATAAAAATTTTTCCATTGATAAAATTCCCTTACTTGTATGATCAATTTTAATCACTGCAATTTTATTACTATTATCCCTCCCAGTTCTAGCAGGT---GCAATTACTATACTTTTAACTGACCGTAACCTTAATACTTCATTTTTTGACCCATCTGGCGGCGGAGATCCTATTTTATATCAACATCTCTTCTGATTTTTTGGACATCCTGAAGTTTATATTTTAATTCTCCCTGGATTTGGGCTAATTTCTCATATTATTATAAATGAAAGAGGAAAAAAA---GAAACATTTGGATCTTTAGGAATAATTTATGCTTTAATAGCAATTGGATTTTTAGGATTTGTTGTATGAGCTCACCATATATTTACTATTGGTTTAGATGTTGATACTCGAGCATATTTCACCTCTGCAACTATAATTATTGCTATTCCAACTGGAATCAAAATTTTTAGATGAATTACT---ACTCTTCATGGTA
-- end --


Download FASTA File

Licensehttp://creativecommons.org/licenses/by/3.0/
Rights holder/AuthorSujeevan Ratnasingham, Paul D.N. Hebert, Barcode of Life Data Systems (BOLD)
Sourcehttp://www.boldsystems.org/index.php/Taxbrowser_Taxonpage?taxid=15812

Race L. alienus HNS , Foerst.

Himalaya, 9,000 ' de hauteur (M. Smythies). L. 2, 7 a 3, 2 mill. Pas de sillon frontal distinct. Brunatre, avec le thorax les antennes et les pattes plus clairs. Scapes et pattes sans poils dresses. Comme les petits exemplaires clairs d'Europe.

LicensePublic Domain
Rights holder/AuthorNo known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.
Sourcehttp://treatment.plazi.org/id/50F3EEF2C5EB1B08BA6A753C4A7514AF

Statistics of barcoding coverage: Lasius alienus:

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 82
Species With Barcodes: 1

Licensehttp://creativecommons.org/licenses/by/3.0/
Rights holder/AuthorSujeevan Ratnasingham, Paul D.N. Hebert, Barcode of Life Data Systems (BOLD)
Sourcehttp://www.boldsystems.org/index.php/Taxbrowser_Taxonpage?taxid=15812
Scratchpads developed and conceived by (alphabetical): Ed Baker, Katherine Bouton Alice Heaton Dimitris Koureas, Laurence Livermore, Dave Roberts, Simon Rycroft, Ben Scott, Vince Smith